Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 16689339 16693741 enh86060

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 16692414 rs145617218 GCCATCACTCAATGGGAAGAGGAGTCC G 1877683
chr11 16692414 rs373280541 GCCATCACTCAATGGGAAGAGGAGTCC G 1877684

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results