Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 17973923 17978180 enh43507

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 17974860 rs535380828 G GATAGGCATACTCAAGCATCAGACAGC 1883387
chr11 17974861 rs535327622 A G 1883388

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results