Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 19543745 19549935 enh13833

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 19546160 rs559120196 AGTACTGGCTTTGGTGGGGGGCTGGGCCTAAAAG A 1889275

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results