EnhancerDB
  1. Home
  2. TFBS
  3. REST[chr3:10814134-10814153]
Chromosome characteristics of REST[chr3:10814134-10814153]
Back to top
Enhancers possibly regulated by REST[chr3:10814134-10814153]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 10811224 10824295 enh20320
Prostate (PC-3) Placenta Prostate (RWPE1) Epithelial (MCF-7)
SNP sites on REST[chr3:10814134-10814153]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 10814145 rs115781266 G A 6544572
chr3 10814146 rs376124062 C A 6544573
chr3 10814149 rs532283797 A G 6544574
chr3 10814151 rs558442070 GCCTCTGCCAGGGGAGCAGGGGACAGCTCGCT G 6544575
Genes possibly regulated by REST[chr3:10814134-10814153]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by REST[chr3:10814134-10814153]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results