Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 58412585 58429935 enh1790

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 58427942 rs201620093 ATCAGGTCATTCATCGGACAT A 2013040

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results