Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 59048405 59054235 enh1796

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 59049532 rs562187567 T TTATGTAAA,TTATGTAAACATACATACATGTAAA 2016055

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results