| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr11 | 63766025 | 63776443 | enh43552 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 63772494 | rs528633683 | C | CTTTATTTA,CTTTATTTATTTATTTATTTA | 2037071 | |
| chr11 | 63772494 | rs60973367 | C | CTTTATTTATTTATTTATTTA,CTTTATTTATTTATTTATTTATTTA | 2037072 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|