Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 63766025 63776443 enh43552

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 63775873 rs147518923 G GAGGCGGGAGGTCCCACGCACACAT 2037113
chr11 63775873 rs6144369 G GAGGCGGGAGGTCCCACGCACACAT 2037114

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results