EnhancerDB
  1. Home
  2. TFBS
  3. PAX9[chr11:63896253-63896270]
Chromosome characteristics of PAX9[chr11:63896253-63896270]
Back to top
Enhancers possibly regulated by PAX9[chr11:63896253-63896270]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 63885258 63916195 enh28837
Bone Marrow (K562) Brain (SK-N-SH) Epithelial (MCF-7) Brain (SK-N-MC) Prostate (RWPE1) Astrocyte Muscle (A673) Thyroid Pancreas Muscle (Myotube) Heart
SNP sites on PAX9[chr11:63896253-63896270]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 63896265 rs143699151 GCTGAGCCCAGACTGGCAGCT G 2038244
chr11 63896265 rs58298373 GCTGAGCCCAGACTGGCAGCT G 2038245
Genes possibly regulated by PAX9[chr11:63896253-63896270]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PAX9[chr11:63896253-63896270]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results