Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 65922785 65933615 enh14007

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 65930174 rs529677078 AGCTTTAGGAGATGAAAACAAG A 2051512
chr11 65930174 rs869150714 AGCTTTAGGAGATGAAAACAAG A 2051513

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results