Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 68263285 68270035 enh1859

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 68267918 rs571513475 GAATACACTTTGTTGGACTTTCACTTTA G 2066087
chr11 68267925 rs371911050 CTT C 2066088
chr11 68267925 rs577320141 CTT C 2066089

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results