Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 69007845 69011995 enh94136

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 69010066 rs141982355 ATCTGGGGTCCACACAGAGGCC A 2071224

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results