EnhancerDB
  1. Home
  2. TFBS
  3. PRDM1[chr11:70092698-70092713]
Chromosome characteristics of PRDM1[chr11:70092698-70092713]
Back to top
Enhancers possibly regulated by PRDM1[chr11:70092698-70092713]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 70084795 70096615 enh14045
Prostate (PC-3) Large Intestine Astrocyte Bone (Osteoblast) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Epithelial (MCF-7)
SNP sites on PRDM1[chr11:70092698-70092713]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 70092698 rs376376693 C CCCAAAGAGAAAGGGATGGGA 2082192
chr11 70092698 rs555849671 C CCCAAAGAGAAAGGGATGGGA 2082193
chr11 70092702 rs78180736 A G 2082194
Genes possibly regulated by PRDM1[chr11:70092698-70092713]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PRDM1[chr11:70092698-70092713]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results