Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 71963765 71970895 enh14064

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 71967031 rs549769130 T TGAATTTAGTTGTATGAGCACA 2092693

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results