| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr11 | 73106668 | 73111328 | enh102448 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr11 | 73108812 | rs537210591 | C | CAGGTGGGTGTTTAGGCCAGGACTG | 2099867 | |
| chr11 | 73108812 | rs565421741 | C | G | 2099868 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|