Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 75241282 75251015 enh1894

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 75243916 rs535245257 GACAGCTGGATTTTCAAACAC G 2110926
chr11 75243918 rs184607531 C A 2110927

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results