Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 78106545 78119815 enh14139
chr11 78113040 78113383 vista11031

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 78113332 rs549725979 AAGGAAGCCTTTGCTTTTTCTTCTCT A 2128401

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results