Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 78106545 78119815 enh14139

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 78117712 rs368477585 AAAATGTCCAGGTTTTAATAG A 2128479
chr11 78117712 rs554645618 AAAATGTCCAGGTTTTAATAG A 2128480

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results