Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 78399745 78404535 enh79941

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 78400429 rs549029361 ATGGGGACACAGTTCTTCCTC A 2130431

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results