EnhancerDB
  1. Home
  2. TFBS
  3. TBX19[chr11:79105613-79105633]
Chromosome characteristics of TBX19[chr11:79105613-79105633]
Back to top
Enhancers possibly regulated by TBX19[chr11:79105613-79105633]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 79099525 79114015 enh28910
Brain (SK-N-SH) Ovary Large Intestine Astrocyte Peripheral Blood (MM.1S) Muscle (Myoblast) Muscle (Myotube)
SNP sites on TBX19[chr11:79105613-79105633]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 79105618 rs553998999 A G 2134797
chr11 79105628 rs538999224 GTGATAACGAACTACTGAGAGTTGAATCA G 2134798
Genes possibly regulated by TBX19[chr11:79105613-79105633]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TBX19[chr11:79105613-79105633]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results