Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 113121805 113130230 enh2013

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 113123772 rs543141496 AGTGTTCTAACTATGTCAAAT A 2271830

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results