Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 113550065 113554615 enh90915

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 113552096 rs570088218 A ACCACCCAGGCCCACCCAGGCCCACCCAGG 2273645

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results