EnhancerDB
  1. Home
  2. TFBS
  3. NFE2L2[chr11:120088828-120088839]
Chromosome characteristics of NFE2L2[chr11:120088828-120088839]
Back to top
Enhancers possibly regulated by NFE2L2[chr11:120088828-120088839]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 120083405 120094079 enh14325
Prostate (RWPE1) Large Intestine Placenta Lung (PC-9) Pancreas Heart
SNP sites on NFE2L2[chr11:120088828-120088839]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 120088834 rs577861771 AGAGCACTGCTCTGGGGAGGGGCTGGGGGCAG A 2310204
chr11 120088834 rs67966065 AGAGCACTGCTCTGGGGAGGGGCTGGGGGCAG A 2310205
Genes possibly regulated by NFE2L2[chr11:120088828-120088839]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFE2L2[chr11:120088828-120088839]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results