Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 121218052 121231755 enh60330

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 121218361 rs367930731 AGACACGGAGAATGTTACCTGAT A 2316190
chr11 121218361 rs71828796 AGACACGGAGAATGTTACCTGAT A 2316191

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results