Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 121460205 121465715 enh80041

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 121464330 rs570083475 CCCTTGTTTGGGTGGAGTGCATCCTTCAGTAG C 2318461

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results