Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 121772925 121777075 enh94151

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 121773669 rs370986242 CATCTGCTTTAGGGAGGACT C 2320426
chr11 121773669 rs71054013 CATCTGCTTTAGGGAGGACT C 2320427

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results