Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 122510743 122520815 enh29216

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 122518642 rs561039416 G GCCCTGTCCCTCTTTTCTCCTC 2324888

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results