Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 123423705 123427855 enh2076

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 123424045 rs11274044 T TTAACTAATATGTAGAAGGAGACC 2333675
chr11 123424045 rs61129032 T TTAACTAATATGTAGAAGGAGACC 2333676

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results