Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 125921381 125925943 enh115494

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 125923631 rs566552986 T TCCCCATACCCACTCTCATACTCTCATAGTCA 2343126

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results