Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 128055694 128065895 enh107521

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 128059917 rs547071941 AAAAGGGCACTTCTCAATGAGGGGAG A 2354302

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results