Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 128727585 128735464 enh43658

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 128729939 rs143201184 A AGGGCACTGCGCAAGAGAGGT 2360872
chr11 128729939 rs539615514 A AGGGCACTGCGCAAGAGAGGT 2360873

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results