Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 131209905 131214595 enh29277

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 131214141 rs565507070 G GAGGCAAGAGAGAGATGGGA 2377268

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results