Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 560525 564675 enh24699

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 563909 rs541926145 C CAGGCAGGTGGTGATGGAGG 10222926

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results