Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 1774032 1780364 enh40726

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 1778426 rs553913081 G T 10227828
chr8 1778428 rs542175105 T TCAGGCGGCTCATTTCCCGTGGGGCC 10227829

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results