Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 1883860 1888683 enh90486

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 1886064 rs571570041 TGGAGTGACTGTGCCAGTGGA T 10228908

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results