Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 2010894 2017215 enh66494

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 2012875 rs551222178 ACATCTCCCTCCTCCTTCTCCTC A 10230308
chr8 2012880 rs546910303 T C 10230309

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results