Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 10742905 10753375 enh24742

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 10745139 rs148419145 T TAGGCCCAGGGCAATCCTGG 10278366
chr8 10745139 rs56312756 T TAGGCCCAGGGCAATCCTGG 10278367

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results