Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 11052925 11057075 enh40749

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 11055306 rs577165754 G GACAGGAATGGCAAGATGCAGAGAAGTGC 10281242

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr8 10753555 11058875 - XKR6 ENSG00000171044.6 11058875 0.75 0.98 3565 8119


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results