| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr8 | 11052925 | 11057075 | enh40749 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr8 | 11055306 | rs577165754 | G | GACAGGAATGGCAAGATGCAGAGAAGTGC | 10281242 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr8 | 10753555 | 11058875 | - | XKR6 | ENSG00000171044.6 | 11058875 | 0.75 | 0.98 | 3565 | 8119 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|