Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 125290531 125297735 enh41534

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 125296434 rs367822707 TGCTCTCTGGTTTCCAGTGGCTCACAG T 10737575

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results