Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 125489045 125494715 enh10510

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 125493061 rs541856008 CCAGTCATCTGATTATTGTACAAAA C 10738483

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results