Chrom Start End Enhancer ID Tissues that enhancer appears More
chr8 125520505 125526135 enh85252

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr8 125523878 rs150961794 C CTCTTTGCTTCTCTTTCTTAG 10738607

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results