Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 3492056 3492792 vista43967

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 3492538 rs534265176 TCATTCATTCCTGCCTTCCCCC T 7358278
chr4 3492543 rs2464043 C T 7358279

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results