Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 89287451 89287809 vista45364

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 89287584 rs142000369 TTTTTTTATTTGTCTTAAGGGCTGAA T 7676521
chr4 89287591 rs73841935 A G 7676522

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results