| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr16 | 86587305 | 86587716 | vista23396 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr16 | 86587620 | rs373861750 | CGGACCAATCGGCTCTCTGTAAAAT | C | 4638590 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr16 | 86563782 | 86588841 | - | MTHFSD | ENSG00000103248.13 | 86588841 | 0.71 | 1.0 | 1207 | 15138 |
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|