Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 260905 270355 enh47990

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 265111 rs71145729 CGTGTGTGTGTGTGTGTGTGTGTGTGTGT C 4683717

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results