Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 122411923 122416131 enh87255

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 122412139 rs146742973 GAAGAGAGCTGTCACCACCCAAAAC G 6987979
chr3 122412139 rs372678296 GAAGAGAGCTGTCACCACCCAAAAC G 6987980

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results