Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 6849925 6854075 enh81171

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 6853259 rs35612824 AGAATGTGTGATCAAACAAAT A 4726711
chr17 6853259 rs75984003 AGAATGTGTGATCAAACAAAT A 4726712

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results