Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 7066505 7074795 enh16958

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 7070600 rs368332974 GCAGAGGCTGCAGTGAGTCAAGATC G 4728456
chr17 7070600 rs548373264 GCAGAGGCTGCAGTGAGTCAAGATC G 4728457

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results