EnhancerDB
  1. Home
  2. TFBS
  3. AR[chr17:13367589-13367604]
Chromosome characteristics of AR[chr17:13367589-13367604]
Back to top
Enhancers possibly regulated by AR[chr17:13367589-13367604]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 13363645 13368275 enh92710
Liver (HepG2)
SNP sites on AR[chr17:13367589-13367604]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 13367590 rs149101664 G A 4761978
chr17 13367594 rs539276908 ACTGTAAGTCCATTAAACCT A 4761979
Genes possibly regulated by AR[chr17:13367589-13367604]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by AR[chr17:13367589-13367604]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results