Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 123394784 123400915 enh35834

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 123396745 rs201250303 TATATATATATATATATATATAC T 6993209

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results